Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7268787
End position: 7268822
Length: 36

DNA sequence
>NC_021658, from 7268787 to 7268822 (36 bp); Sorangium cellulosum So0157-2 TCACCCCGCTTCTCGCCCCGCTTCTCACCCCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7268502-7269068	Sequence	SCE1572_25320 - hypothetical protein (Protein is coded in complementary strand; from 7269068 to 7268502)