Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7256387
End position: 7256413
Length: 27

DNA sequence
>NC_021658, from 7256387 to 7256413 (27 bp); Sorangium cellulosum So0157-2 TCGAGCCGCTCGAGCCGCTCGAGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7256372-7259446	Sequence	SCE1572_25275 - hypothetical protein (Protein is coded in complementary strand; from 7259446 to 7256372)