Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7247453
End position: 7247476
Length: 24

DNA sequence
>NC_021658, from 7247453 to 7247476 (24 bp); Sorangium cellulosum So0157-2 CGGCCTCCGCCTCGCCCTCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7247026-7247574	Sequence	SCE1572_25210 - hypothetical protein (Protein is coded in complementary strand; from 7247574 to 7247026)