Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 722357
End position: 722401
Length: 45

DNA sequence
>NC_021658, from 722357 to 722401 (45 bp); Sorangium cellulosum So0157-2 CCGCGTCCCCGCGCGGGGCGTCCCCGCTCGGGGCCTCCCCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 721672-722934	Sequence	SCE1572_02690 - hypothetical protein (Protein is coded in complementary strand; from 722934 to 721672)