Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7169243
End position: 7169267
Length: 25

DNA sequence
>NC_021658, from 7169243 to 7169267 (25 bp); Sorangium cellulosum So0157-2 CAGCGCAGCGCTGCGCCGCGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7161086-7178158	Sequence	SCE1572_25055 - hypothetical protein (Protein is coded in complementary strand; from 7178158 to 7161086)