Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6995319
End position: 6995342
Length: 24

DNA sequence
>NC_021658, from 6995319 to 6995342 (24 bp); Sorangium cellulosum So0157-2 GCCTCGACCTCGGGCTCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6993756-6995948	Sequence	SCE1572_24750 - hypothetical protein (Protein is coded in complementary strand; from 6995948 to 6993756)