Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6986515
End position: 6986542
Length: 28

DNA sequence
>NC_021658, from 6986515 to 6986542 (28 bp); Sorangium cellulosum So0157-2 TCGCGCGTCACGCGTCACGCGTCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6986530-6986625	Sequence	SCE1572_24735 - hypothetical protein (Protein is coded in complementary strand; from 6986625 to 6986530)