Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6948931
End position: 6948990
Length: 60

DNA sequence
>NC_021658, from 6948931 to 6948990 (60 bp); Sorangium cellulosum So0157-2 CGCCGTCGCCGCCCGTGCCGTCGCCGCCCGCGCCGTCGCCGCCCGTGCCGTCGCCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6947328-6949106	Sequence	SCE1572_24655 - hypothetical protein (Protein is coded in complementary strand; from 6949106 to 6947328)