Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6882508
End position: 6882543
Length: 36

DNA sequence
>NC_021658, from 6882508 to 6882543 (36 bp); Sorangium cellulosum So0157-2 CGCCGCTCGCCGCGCCGCTCGCCGCGCCGCTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6882468-6883472	Sequence	SCE1572_24435 - hypothetical protein (Protein is coded in complementary strand; from 6883472 to 6882468)