Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 687504
End position: 687557
Length: 54

DNA sequence
>NC_021658, from 687504 to 687557 (54 bp); Sorangium cellulosum So0157-2 CCGGCATCGGCGCGGCGGCCGGCATCGGCGCGGCGAGCGGCATCGGCGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 686461-688782	Sequence	SCE1572_02515 - hypothetical protein (Protein is coded in complementary strand; from 688782 to 686461)