Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6865014
End position: 6865037
Length: 24

DNA sequence
>NC_021658, from 6865014 to 6865037 (24 bp); Sorangium cellulosum So0157-2 CGACGCCGCCGCCGCCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6862877-6867802	Sequence	SCE1572_24390 - hypothetical protein (Protein is coded in complementary strand; from 6867802 to 6862877)