Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 686338
End position: 686382
Length: 45

DNA sequence
>NC_021658, from 686338 to 686382 (45 bp); Sorangium cellulosum So0157-2 CGCCGCCCTCGGCCCCGCCGCCGGCGTCCCCGCCGCCGGCGTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 684684-686441	Sequence	SCE1572_02510 - hypothetical protein (Protein is coded in complementary strand; from 686441 to 684684)