Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6852540
End position: 6852587
Length: 48

DNA sequence
>NC_021658, from 6852540 to 6852587 (48 bp); Sorangium cellulosum So0157-2 CAGCGCCTCCTTCTTCGCCTCCTTGACCGCCTCCTTGACCGCCTCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6852295-6853311	Sequence	SCE1572_24345 - hypothetical protein (Protein is coded in complementary strand; from 6853311 to 6852295)