Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 682083
End position: 682127
Length: 45

DNA sequence
>NC_021658, from 682083 to 682127 (45 bp); Sorangium cellulosum So0157-2 CGCCTGGGCCGCCTTCGCCTCGGCGGGCTTCGCCTCGGCGGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 681541-682239	Sequence	SCE1572_02485 - hypothetical protein (Protein is coded in complementary strand; from 682239 to 681541)