Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6813729
End position: 6813782
Length: 54

DNA sequence
>NC_021658, from 6813729 to 6813782 (54 bp); Sorangium cellulosum So0157-2 CCGCCGTCGCCGGGCGCGCCGCCGTCGCCGGGCCCACCGCCGACGCCGGAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6812310-6813989	Sequence	SCE1572_24215 - Ricin B lectin (Protein is coded in complementary strand; from 6813989 to 6812310)