Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6804440
End position: 6804463
Length: 24

DNA sequence
>NC_021658, from 6804440 to 6804463 (24 bp); Sorangium cellulosum So0157-2 TCGTCGTCGTCGCCGTCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6804122-6804760	Sequence	SCE1572_24190 - hypothetical protein (Protein is coded in complementary strand; from 6804760 to 6804122)