Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6780276
End position: 6780299
Length: 24

DNA sequence
>NC_021658, from 6780276 to 6780299 (24 bp); Sorangium cellulosum So0157-2 TGCGCCTGCCCCAGCGCCTTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6779190-6780641	Sequence	SCE1572_24105 - hypothetical protein (Protein is coded in complementary strand; from 6780641 to 6779190)