Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 673322
End position: 673366
Length: 45

DNA sequence
>NC_021658, from 673322 to 673366 (45 bp); Sorangium cellulosum So0157-2 TCGTCCTTGGCCTGCTCGTCCTTGGCCTGCTCGTCCTTGGCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 672575-673513	Sequence	SCE1572_02465 - hypothetical protein (Protein is coded in complementary strand; from 673513 to 672575)