Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6649074
End position: 6649097
Length: 24

DNA sequence
>NC_021658, from 6649074 to 6649097 (24 bp); Sorangium cellulosum So0157-2 GCCGGCGCCGCCTCCGGCGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6647775-6649862	Sequence	SCE1572_23580 - hypothetical protein (Protein is coded in complementary strand; from 6649862 to 6647775)