Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6621648
End position: 6621707
Length: 60

DNA sequence
>NC_021658, from 6621648 to 6621707 (60 bp); Sorangium cellulosum So0157-2 CCCCGCCGCCGCCGCCCCCGCCGCCGCCACCGCCACCGCCACCGCCGCCACCGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6621017-6622549	Sequence	SCE1572_23505 - peptidase M10 (Protein is coded in complementary strand; from 6622549 to 6621017)