Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6614750
End position: 6614773
Length: 24

DNA sequence
>NC_021658, from 6614750 to 6614773 (24 bp); Sorangium cellulosum So0157-2 CCACGGCCTCGGCCACGTCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6614653-6615465	Sequence	SCE1572_23485 - malonic semialdehyde reductase (Protein is coded in complementary strand; from 6615465 to 6614653)