Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6573717
End position: 6573740
Length: 24

DNA sequence
>NC_021658, from 6573717 to 6573740 (24 bp); Sorangium cellulosum So0157-2 GCACCAGCACGAGCACGAGCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6573122-6574183	Sequence	SCE1572_23305 - hypothetical protein (Protein is coded in complementary strand; from 6574183 to 6573122)