Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6552322
End position: 6552366
Length: 45

DNA sequence
>NC_021658, from 6552322 to 6552366 (45 bp); Sorangium cellulosum So0157-2 CGGCGGCACCGCGGCCGGCGGTGGCGCGGCCGGCCGCGGCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6552137-6552601	Sequence	SCE1572_23215 - hypothetical protein (Protein is coded in complementary strand; from 6552601 to 6552137)