Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6532970
End position: 6532999
Length: 30

DNA sequence
>NC_021658, from 6532970 to 6532999 (30 bp); Sorangium cellulosum So0157-2 GTCGGGCGGCGGCGGGCGGAGGCGCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6532266-6534071	Sequence	SCE1572_23155 - hypothetical protein (Protein is coded in complementary strand; from 6534071 to 6532266)