Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6428700
End position: 6428744
Length: 45

DNA sequence
>NC_021658, from 6428700 to 6428744 (45 bp); Sorangium cellulosum So0157-2 GGGCTCGATGGGCTTCGGCTCGGCGGGCTTGGGCTCGACGGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6428689-6429609	Sequence	SCE1572_22795 - hypothetical protein (Protein is coded in complementary strand; from 6429609 to 6428689)