Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6420201
End position: 6420224
Length: 24

DNA sequence
>NC_021658, from 6420201 to 6420224 (24 bp); Sorangium cellulosum So0157-2 GCGCGAGCGCGAGCGCGAGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6419018-6420814	Sequence	SCE1572_22755 - cell wall hydrolase (Protein is coded in complementary strand; from 6420814 to 6419018)