Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6270500
End position: 6270539
Length: 40

DNA sequence
>NC_021658, from 6270500 to 6270539 (40 bp); Sorangium cellulosum So0157-2 GCGCGCCTCAGCGAGCGTCAGCGAGCGTCAGCGAGCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6270538-6270975	Sequence	SCE1572_22160 - 50S rRNA methyltransferase (Protein is coded in complementary strand; from 6270975 to 6270538)