Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6229243
End position: 6229266
Length: 24

DNA sequence
>NC_021658, from 6229243 to 6229266 (24 bp); Sorangium cellulosum So0157-2 CGACCTCGTCCTCGTCCTCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6229125-6229898	Sequence	SCE1572_22005 - hypothetical protein (Protein is coded in complementary strand; from 6229898 to 6229125)