Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6220531
End position: 6220566
Length: 36

DNA sequence
>NC_021658, from 6220531 to 6220566 (36 bp); Sorangium cellulosum So0157-2 GCGCGAAGAGCACCCCGAAGAGCAGCACGATGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6220398-6221072	Sequence	SCE1572_21970 - CDP-diacylglycerol--serine O-phosphatidyltransferase (Protein is coded in complementary strand; from 6221072 to 6220398)