Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 620835
End position: 620858
Length: 24

DNA sequence
>NC_021658, from 620835 to 620858 (24 bp); Sorangium cellulosum So0157-2 CAGCCCCAGCCCGAGCCCCCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 620716-622275	Sequence	SCE1572_02290 - hypothetical protein (Protein is coded in complementary strand; from 622275 to 620716)