Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6117973
End position: 6117999
Length: 27

DNA sequence
>NC_021658, from 6117973 to 6117999 (27 bp); Sorangium cellulosum So0157-2 CCCGCCCTCGCCGCCCTCGCCGCCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6117704-6119221	Sequence	SCE1572_21640 - hypothetical protein (Protein is coded in complementary strand; from 6119221 to 6117704)