Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6091244
End position: 6091270
Length: 27

DNA sequence
>NC_021658, from 6091244 to 6091270 (27 bp); Sorangium cellulosum So0157-2 GACGACGTCGATGACGTCGACGACCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6089868-6091418	Sequence	SCE1572_21570 - hypothetical protein (Protein is coded in complementary strand; from 6091418 to 6089868)