Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6023921
End position: 6023965
Length: 45

DNA sequence
>NC_021658, from 6023921 to 6023965 (45 bp); Sorangium cellulosum So0157-2 CGGCGCCGCCTCGACCGGAGCCGCCTCGGATGGAGTCGCCTCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6022839-6023996	Sequence	SCE1572_21335 - hypothetical protein (Protein is coded in complementary strand; from 6023996 to 6022839)