Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6021246
End position: 6021269
Length: 24

DNA sequence
>NC_021658, from 6021246 to 6021269 (24 bp); Sorangium cellulosum So0157-2 GGCGGCGGCGCCGGCGGGGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6020253-6022316	Sequence	SCE1572_21330 - hypothetical protein (Protein is coded in complementary strand; from 6022316 to 6020253)