Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5984521
End position: 5984556
Length: 36

DNA sequence
>NC_021658, from 5984521 to 5984556 (36 bp); Sorangium cellulosum So0157-2 CTTCCACGTCGACTTCCACGTCGACTTCCACGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5984415-5984618	Sequence	SCE1572_21205 - hypothetical protein (Protein is coded in complementary strand; from 5984618 to 5984415)