Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5957989
End position: 5958012
Length: 24

DNA sequence
>NC_021658, from 5957989 to 5958012 (24 bp); Sorangium cellulosum So0157-2 ACCGAGACAGAGGCCGAGCCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5957438-5958034	Sequence	SCE1572_21105 - hypothetical protein (Protein is coded in complementary strand; from 5958034 to 5957438)