Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5947651
End position: 5947686
Length: 36

DNA sequence
>NC_021658, from 5947651 to 5947686 (36 bp); Sorangium cellulosum So0157-2 CTGTGCGCGCCCTTGTGCGCGCCCCTGCGCTCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5947445-5947951	Sequence	SCE1572_21070 - hypothetical protein (Protein is coded in complementary strand; from 5947951 to 5947445)