Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5873646
End position: 5873669
Length: 24

DNA sequence
>NC_021658, from 5873646 to 5873669 (24 bp); Sorangium cellulosum So0157-2 GCGAGCGCGAACCCGAGCGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5872224-5874965	Sequence	SCE1572_20775 - phosphoenolpyruvate carboxylase (Protein is coded in complementary strand; from 5874965 to 5872224)