Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5858240
End position: 5858275
Length: 36

DNA sequence
>NC_021658, from 5858240 to 5858275 (36 bp); Sorangium cellulosum So0157-2 CCGCCCGCGCCGCCCGCGCCGCCCGTGCCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5856758-5858557	Sequence	SCE1572_20725 - hypothetical protein (Protein is coded in complementary strand; from 5858557 to 5856758)