Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5848525
End position: 5848569
Length: 45

DNA sequence
>NC_021658, from 5848525 to 5848569 (45 bp); Sorangium cellulosum So0157-2 CGGCGGCATCGTCGACGGCGGCCTCGTCGACGGCGGCCTCGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5848001-5849584	Sequence	SCE1572_20700 - hypothetical protein (Protein is coded in complementary strand; from 5849584 to 5848001)