Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5808623
End position: 5808646
Length: 24

DNA sequence
>NC_021658, from 5808623 to 5808646 (24 bp); Sorangium cellulosum So0157-2 CGCCGCCTCCGCCGGCGCCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5806390-5808852	Sequence	SCE1572_20540 - hypothetical protein (Protein is coded in complementary strand; from 5808852 to 5806390)