Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5775978
End position: 5776004
Length: 27

DNA sequence
>NC_021658, from 5775978 to 5776004 (27 bp); Sorangium cellulosum So0157-2 CGCCGCCGACCCCGCCGACGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5774171-5776543	Sequence	SCE1572_20425 - hypothetical protein (Protein is coded in complementary strand; from 5776543 to 5774171)