Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5761459
End position: 5761483
Length: 25

DNA sequence
>NC_021658, from 5761459 to 5761483 (25 bp); Sorangium cellulosum So0157-2 GGCTCGGCGCGGCACGGCTCGACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5759747-5761474	Sequence	SCE1572_20365 - peptide ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 5761474 to 5759747)