Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5742809
End position: 5742844
Length: 36

DNA sequence
>NC_021658, from 5742809 to 5742844 (36 bp); Sorangium cellulosum So0157-2 TGCCGTCGCCGGTGCCGTCGCCGATGCCGTTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5741716-5742921	Sequence	SCE1572_20285 - hypothetical protein (Protein is coded in complementary strand; from 5742921 to 5741716)