Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5715655
End position: 5715699
Length: 45

DNA sequence
>NC_021658, from 5715655 to 5715699 (45 bp); Sorangium cellulosum So0157-2 CGGTCGCGACGGGCGCGGCCGCGACGGGCTGGGTCGCGGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5715630-5716862	Sequence	SCE1572_20185 - hypothetical protein (Protein is coded in complementary strand; from 5716862 to 5715630)