Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 56914
End position: 56949
Length: 36

DNA sequence
>NC_021658, from 56914 to 56949 (36 bp); Sorangium cellulosum So0157-2 CGGCGCTCTACCCGGCGCTCTGCCCGGCGCTCTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 56946-58268	Sequence	SCE1572_00185 - hypothetical protein (Protein is coded in complementary strand; from 58268 to 56946)