Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 568955
End position: 568978
Length: 24

DNA sequence
>NC_021658, from 568955 to 568978 (24 bp); Sorangium cellulosum So0157-2 CGCGAGCCCGAGCGCGAGCTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 568776-569510	Sequence	SCE1572_02140 - cobalt transporter CbiM (Protein is coded in complementary strand; from 569510 to 568776)