Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 562685
End position: 562708
Length: 24

DNA sequence
>NC_021658, from 562685 to 562708 (24 bp); Sorangium cellulosum So0157-2 GACCGCGATCGCGAGCGCGACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 562623-563429	Sequence	SCE1572_02100 - hypothetical protein (Protein is coded in complementary strand; from 563429 to 562623)