Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5573759
End position: 5573785
Length: 27

DNA sequence
>NC_021658, from 5573759 to 5573785 (27 bp); Sorangium cellulosum So0157-2 TCGATGACGTCGATGACGTCGATGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5573695-5573880	Sequence	SCE1572_19690 - hypothetical protein (Protein is coded in complementary strand; from 5573880 to 5573695)