Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 556238
End position: 556261
Length: 24

DNA sequence
>NC_021658, from 556238 to 556261 (24 bp); Sorangium cellulosum So0157-2 GCGCCGGGGCCGACGCCGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 555482-556285	Sequence	SCE1572_02065 - precorrin-2 C20-methyltransferase (Protein is coded in complementary strand; from 556285 to 555482)